Chapter 13

25問 • 1年前

問題一覧

What would result from a single nucleotide deletion (point mutation) within the coding sequence of a structural gene?

A frameshift mutation, producing a completely different amino acid sequence

CCR5 is a cell surface receptor protein of white blood cells that attracts them to specific tissue and organs to elicit an immune response. It is also the receptor to which R5 strains of HIV bind to and enter T cells. Between 5 and 14% of people from Northern European descent possess an allele known as CCR5-432. In this allele, a 32 base pair section of the gene has been deleted. What phenotype would you predict for people carrying the CCR5-132 allele?

People with CCR5-132 will likely have impaired immune function, but will have resistance to HIV infection.

Beta-thalassemia is a disease that results from the reduction or absence of a functional -globin gene. Affected patients exhibit moderate to severe anemia, poor growth, and possibly skeletal abnormalities. It is known that there are various mechanisms of mutation that result in beta-thalassemia. You are studying a group of individuals with beta-thalassemia in order to better understand the disease. Upon sequencing the -globin gene, you notice that only about half of the patients in your study have deletions in their -globin gene. The other half has no abnormalities in the sequence of this gene. From other tests, you know that these patients do in fact have beta-thalassemia, as they are deficient in -globin protein and other members of their families also suffer from similar conditions. What is the most likely explanation for the presence of this genetic disease in people no abnormalities in the sequence of their -globin gene?

There is a microorganism, such as a virus, that is causing these symptoms.

Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp

Base addition -Frameshift

Which of the following is true concerning a somatic cell mutation?

Only a small group of cells within the organism is affected by the mutation.

Which of the following types of physical mutagens produces thymine dimer mutations?

UV light

In the Ames test, mutagenicity is normally tested on a strain of Salmonella that cannot synthesize the amino acid histidine, and therefore require histidine in the growth media to survive. You are trying to test if the new cola product you have concocted is dangerous, and want to performithe Ames test, but you cannot obtain this strain of Salmonella. Below are the bacteria you have in your collection, which one will you use to test your tasty new beverage?

An E. coli bacteria that has a mutated biotin gene, and cannot grow without being supplemented with the vitamin biotin.

All of the following are chemical mutagens EXCEPT

X-rays

The Lederbergs conducted an experiment that showed that mutations were random events. The alternative view, proposed by Lamarck, predicted that organisms changed in response to their environment and would pass on that change to their offspring. If Lamarck's hypothesis was correct, which results would you expect the Lederbergs to have seen?

There would be bacterial colonies on the master plate and the two plates with TI phage would have a few colonies growing in different locations.

Ionizing radiation can produce which of the following?

free radicals

Which of the following base pairs would be targeted and repaired by a mismatch repair system?

A-G

A repair enzyme recognizes an incorrect structure in the DNA and directly converts it back to the correct structure. Which of the following DNA repair systems is responsible for the correction?

direct repair

Should a genetic abnormality arise,________ prevent a cell from progressing uncontrollably through the cell cycle

checkpoint proteins

Study the figure below of two non-homologous chromosomes. Several loci have been identified on these chromosomes. Next, study the changes that have taken place, resulting in the mutated chromosomes, and determine which mutated chromosomes are the most likely to lead to cancer?

Which of the following is most likely to occur when a tumor-suppressor gene is mutated?

The tumor-suppressor gene and resulting protein may lose its function and ability to suppress cell proliferation.

At what phase of the cell cycle does p53 halt cell division if it senses DNA damage?

Which of the following is NOT a typical cellular change that occurs during lung cancer?

elevated gas transport

Study the loci that have been identified on the two non-homologous chromosomes below and determine what mutation is the most likely to lead to cancer.

A deletion occurs in gene R, so that it represses the activity of gene T.

Which of the following LEAST belongs with the others?

direct repair

When cancer cells have the ability to migrate to other parts of the body, they are said to be

metastatic.

If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone?

gene amplification.

Which of the following events must occur to cause a chromosomal translocation, such as that seen in individuals with chronic myelogenous leukemia (CML)?

Two different chromosomes must break.

Which of the following statements about cancer is FALSE?

Most cancers involve genetic changes that are passed from parent to offspring.

Study the mutations below and determine which is the most likely to lead to cancer.

A mutation that caused the cyclin-dependent kinase that interacts with Rb to be overactive

Which of the following is an overgrowth of cells that serves no useful purpose?

Tumor

chapter 21

Madeline Joslyn · 46回閲覧 · 25問 · 1年前

chapter 21